The Frasch Lab          

Escapement Mechanism Hypothesis

For additional information concerning this hypothesis visit the simulations page.

 We have found evidence that the F1Fo ATP synthase employs an escapement mechanism during ATP synthesis (8, and in the following paper).  In this mechanism, the trans-membrane proton gradient provides constant torque to the g subunit (via the c-subunit ring).  The interactions between the g and ab-subunit ring prevent this rotation until the empty catalytic site binds substrate. When the H-bonds and salt bridges at the catch loop are broken as the result of substrate binding, the torque on the g subunit is greater than the energy in the remaining H-bonds such that rotation of the g subunit induces the conformational changes in the catalytic sites necessary for ATP synthesis.

Zhou et al. (13) demonstrated that substrate binding was a prerequisite of proton gradient-driven rotation in E. coli F₁F_o by direct observation of rotation via the flag epitope. Mutations to residues in the catch loop have been found in naturally occurring second site revertants of the inhibitory gM23K mutant (7) . The gM23K mutation was postulated to form an additional H-bond to the DELSEED region of the b subunit. We note that in every case, the reported revertants cause the loss or weakening of a salt bridge or an H-bond either in the catch loop or near the g subunit C-terminus. Second site mutations to restore ATP synthase activity to gQ269E or gT273V had similar effects and identified a third important location in the g subunit N-terminus (14) . We note that several intersubunit H-bonds are present at the N-terminus of the g subunit. These results suggest that the sum of the energy in the intersubunit H-bonds and salt bridges, regardless of their location, must not be above or below a certain value for the enzyme to function.

If the steps in ATP synthesis are the reverse of those during hydrolysis, the first synthesis step involves a 30° rotation of the g subunit that forms the tightly wound coiled coil. The available data suggests that the intersubunit H-bonds and salt bridges appear to be stronger in this conformation. Consequently, the proton-motive force may be capable of driving the 30° rotation even though substrate has not bound to the empty catalytic site. The energy of the proton gradient may be sufficient to induce rotations greater than 30° that induce conformations of the catalytic sites that are not conducive to product formation.  Details of our recent evidence of the participation of the catch-loop in the escapement mechanism are described below (Greene and Frasch (2003) J. Biol. Chem 278, 51594-51598).

Interactions between gR268, gQ269 and the b Subunit Catch-Loop of

 E. Coli F₁ ATPase are Important for Catalytic Activity †.

Matthew D. Greene and Wayne D. Frasch*

† This work was supported by National Institutes of Health Grant GM50202.

To download PDF of this paper from JBC click here

Summary

Removal of the ability to form a salt bridge or hydrogen bonds between the b subunit catch loop (bY297 - D305) and the g subunit of E coli F₁F_o ATP synthase significantly altered the ability of the enzyme to hydrolyze ATP and the bacteria to grow via oxidative phosphorylation. Residues bT304, bD305, bD302, gQ269, and gR268 were found to be very important for ATP hydrolysis catalyzed by soluble F₁-ATPase, and the latter four residues were also very important for oxidative phosphorylation. The greatest effects on catalytic activity were observed by the substitution of sidechains that contribute to the shortest and/or multiple H-bonds as well as the salt bridge. Residue bD305 would not tolerate substitution with V or S and had extremely low activity as bD305E, suggesting that this residue is particularly important for synthesis and hydrolysis activity. These results provide evidence that tight winding of the g subunit coiled coil is important to the rate-limiting step in ATP hydrolysis, and are consistent with an escapement mechanism for ATP synthesis in which abg intersubunit interactions provide a means to make substrate binding a prerequisite of proton gradient-driven g subunit rotation.

Introduction

The F₁F_o -ATP synthase¹ uses a non-equilibrium transmembrane proton gradient to catalyze the formation of ATP from ADP and inorganic phosphate. The enzyme consists of two protein complexes, the membrane embedded F_o complex, which couples proton translocation to the synthesis of ATP, and the membrane extrinsic F₁ complex, which contains the catalytic sites. The F₁ portion consists of five subunits that occur with a stoichiometric ratio of (ab)₃gde. The a and b subunits are arranged alternately like the sections of an orange around a central g subunit stalk (see Fig. 1A). Catalytic activity occurs at the ab interfaces, primarily within each b subunit. The F₁ portion can be isolated from F_o and function as an ATPase (1) . The F₁ functions as an ATP driven rotary motor (2) which moves through a complete 360° rotation in three discrete 120° steps. The binding of Mg²⁺-ATP to a catalytic site initiates a 90° rotation of the g subunit to form an intermediate state. Following a 2ms pause, a 30° rotation concurrent with product release completes the catalytic cycle (3) .

            Differences in the conformation of the g subunit have been observed between ground state F₁ structures (4,5) and the (ADP×AlF₄^-)₂F₁ structure by Menz et al (6) , a putative post-transition state structure that contains Mg²⁺ADP and SO₄^2- at the low affinity catalytic site, and the transition state analog Mg²⁺-ADP-fluoroaluminate bound at the other two catalytic sites. In this intermediate state structure the position of the g subunit used to attach the probe for rotation studies is rotated about 30° from its position in ground state structures. As a consequence, the coiled coil of the g subunit is more tightly wound in the (ADP×AlF₄^-)₂F₁ structure than in the ground state.

            The major specific interaction between the helical coiled coil of the g subunit and the (ab)₃ subcomplex occurs with gR268² and gQ269 in all F₁ structures. These residues form a ‘catch’ with a loop of the b subunit in the empty catalytic site conformation that encompasses residues 297-305 (Figure 1A). In the ground state structure, this catch results from a salt bridge between gR268 and bD302 and from H-bonds between gQ269, bD302 and bT304 (Figure 1B). In the (ADP×AlF₄^-)₂ F₁ structure, the catch loop of the catalytic site with bound Mg²⁺-ADP and SO₄^2- also interacts with gR268 and gQ269. However, the interactions of these residues with the catch loop in (ADP×AlF₄^-)₂ F₁ differ from the ground state, such that gR268 and gQ269 are rotated about 15° as shown in Figure 1C. Among other differences, gR268 forms a second salt bridge with bD305 of the catch loop in (ADP×AlF₄^-)₂F₁.

            The region of the g subunit that interacts with the b subunit catch loop was one of three g subunit locations where second site mutations suppressed the deleterious effects of ATP synthase activity caused by the F₁ gM23K mutant (7) . Based on these observations, Al-Shawi et al (7) concluded that gM23K decreases the coupling efficiency of F₁F_o due to an increase in the energy of interaction between b and g subunits. Catch loop residue bY297 is about 5.5 Å from the terminal phosphate in the conformation of the catalytic site that binds Mg²⁺-AMPPNP (4) . Site directed mutants of this residue in Chlamydomonas chloroplast F₁ decreased Mg²⁺-ATPase activity and changed the EPR spectrum of vanadyl bound as VO²⁺-ATP to the low affinity catalytic site (8) . These changes indicated that this functional surrogate for the Mg²⁺ cofactor used bY297 as a metal ligand during the initial binding of metal-nucleotide to the empty catalytic site. Based on these observations it was proposed that intersubunit H-bonds between the g subunit and the (ab)₃ ring prevent rotation driven by the proton gradient until the empty catalytic site binds substrate. Deformation of the catch loop-g subunit interactions induced by substrate binding would provide an escapement mechanism that would maintain tight coupling between the proton-motive force and ATP synthesis.

In this study we have mutated gR268 and gQ269 as well as residues in the catch loop of the b subunit in order to assess the importance of the intersubunit interactions at this location to catalytic activity. The results presented here suggest that these subunit interactions are very important to ATP hydrolysis and synthesis. 

Figure 1. Interactions between the g subunit and the b_E-catch loop of bovine F₁-ATPase. (A) Location of the interactions between the catch loop of b_E (green) and the g subunit (red) in the structure reproduced from Protein Data Bank file 1E79 using Web Lab Viewer from Molecular Simulations, Inc. Subunits a_E and b_TP are not shown for clarity. Details of the b_E-catch loop-g subunit interactions in the ground state F₁ structure (B) and the (ADP^.AlF₄^-)₂F₁ structure (C) are reproduced from Protein Data Bank files 1E1Q and 1H8E, respectively, using Web Lab Viewer. Residues are labeled using E. coli numbering.

Experimental Procedures

          Plasmid p3U⁺ containing the entire E. Coli unc operon and the AN887 strain of E. Coli, which contains a Mu phage suppression of the endogenous unc operon, were a generous gift from T. Duncan and R. Cross. Plasmid pLysS (Novagen) that encodes T7 lysozyme was inserted to assist with breaking of the E. Coli cells, and to provide chloramphenicol resistance. Transformation of the AN887 strain by plasmid pLysS resulted in the strain ANLS. Construction of pXL1 was performed by insertion of a six histidine residue tag immediately after the start codon of unc A, which encodes the F₁ a subunit, using the Stratagene Chameleon Double Stranded, Site-Directed Mutagenesis Kit. The mutagenic primer was

5’TAAGGGGACTGGAGCATGCATCACCATCACCATCACCAGCTGAATTCCACCGAA-3’. The italicized and underlined base insertions add a 6XHis tag, while the bold base change introduces a PvuII site (CAA to CAG).  The selection primer utilized was

5’-CTGTGACTGGTGACGCGTCAACCAAGTC-3’. Here the italicized and underlined base changes convert the unique restriction site ScaI to MluI (AGTACT to ACGCGT). The desired mutations were first identified by screening with PvuII, and then confirmed by DNA sequencing using ABI prism automatic sequencing, as were the sequences of all other mutations. Strain AN887 was transformed via insertion of pXL1 by electroporation (9) .  A further mutation, gS193C was made to facilitate attachment of rotation probes for future studies. The mutagenic primer utilized was 5’-CTGCCGTTACCGGCATGCGATGATGATGATCTG-3’, and an XmnI restriction site was deleted through the following mutagenic primer: 5’-CATCATTGGAAAACGCTCTTCGGGGCG-3’. The resulting cell line that contains the 6XHis tag, gS193C mutation, and XmnI deletion is referred to as XL10.

The gR268L, gQ269L, bD302V, bT304A, bD302T, bD305V, bD305S and bD305E mutants were prepared in plasmid pXL1 using the Stratagene Quick Change XL Site-Directed Mutagenesis Kit with the oligonucleotide primers

5’-GGTATACAACAAAGCTCTTCAGGCCAGCATTACTCAG-3’, and its complement 5’-CCTGAGTAATGCTGGCCTGAAGAGCTTTGTTGTATACC-3’ for creation of gR268L, 5’-GGTATACAACAAAGCTCGTCTGGCCAGCATTACTCAGG-3’, and its complement 5’-CCTGAGTAATGCTGGCCAGACGAGCTTTGTTGTATACC-3’ for creation of gQ269L, 5’-GTATACGTACCTGCGGATGTCTTGACTGACCCG-3’ and its complement 5’-CGGGTCAGTCAAGACATCCGCAGGTACGTATAC-3’ for the creation of bD302V, 5’-CCTGCGGATGACTTGGCTGACCCGTCTCCG-3’ and its complement 5’-CGGAGACGGGTCAGCCAAGTCATCCGCAGG-3’ for creation of bT304A, 5’-GTATACGTACCTGCGGATACCTTGACTGACCCG-3’ and its complement 5’-CGGGTCAGTCAAGGTATCCGCAGGTACGTATAC-3’ for the creation of bD302T, 5’-GCGGATGACTTGACTGTTCCGTCTCCGGC-3’ and its complement 5’-GCCGGAGACGGAACAGTCAAGTCATCCGC-3’ for the creation of bD305V, 5’-GCGGATGACTTGACTAGCCCGTCTCCGGC-3’ and its complement 5’-GCCGGAGACGGGCTAGTCAAGTCATCCGC-3’ for the creation of bD305S, and 5’-GCGGATGACTTGACTGAACCGTCTCCGGC-3’ and its complement 5’-GCCGGAGACGGTTCAGTCAAGTCATCCGC-3’ for the creation of bD305E. The resulting plasmid was used to transform the ANLS strain.

The F₁-ATPase was purified from E. coli using a modified form of the procedure described by Wise (10) . Cells were grown on LB agar plates enriched with 10mM MgSO₄ and 20mM glucose, containing 50 mg/mL ampicillin and 34 mg/mL chloramphenicol. Single colonies were picked and transferred to 250mL flasks containing LB medium with the same supplements and grown overnight at 37°C, and shaken at 250 rpm. Overnight cultures were then transferred to 2L baffled flasks containing 1L of minimal medium (60 mM K₂HPO₄, 40 mM NaH₂PO₄, 15 mM (NH₄)₂SO₄) with 50 mg/mL ampicillin, 34 mg/mL chloramphenicol and glucose to a final concentration of 30mM. Cells were grown until late log phase at 37°C and shaken at 250 rpm. The cultures were then harvested by centrifugation at 6000xg.

            Prior to dissociation of F₁ from F_o, membranes were washed once with 50 mM TES (pH 8.0), 40mM eACA, 5%(v/v) glycerol, and 4.8 mM para-aminobenzamidine. Removal of F₁ was accomplished via washing of membranes with 5 mM TES (pH 8.0), 40mM eACA, 5%(v/v) glycerol, and 1.0 mM EDTA. Dithiothreitol was excluded from all buffers to avoid reducing the nickel column material. Membranes were then centrifuged at 100,000xg, and the supernatant containing F₁ was concentrated down to approximately 5 mL via pressure dialysis using an Amicon YM100 membrane. Nickel affinity chromatography was utilized to purify the 6X His-tagged F₁ under native conditions as described in the Qiagen Ni-NTA Superflow product manual. Proteins removed from membranes in earlier steps were exchanged into nickel column Binding Buffer (25mM Tris-HCl pH 8.0, 150mM NaCl, 10% glycerol, 1mM imidiazole, 1mM ATP). Buffer exchange was accomplished by concentrating the crude F₁ extract to less than 5% of the original volume by pressure dialysis using an Amicon YM100 membrane followed by dilution in Binding Buffer. Diluted F₁ was stirred in the presence of Ni-NTA column material for one hour, and packed into a column. Unwanted proteins were removed by flushing the column in Wash Buffer (25mM Tris-HCl pH 8.0, 150mM NaCl, 10% glycerol, 10mM imidiazole, 1mM ATP). The purified 6His-tagged F₁ was then removed with Elution Buffer (25mM Tris-HCl pH 8.0, 150mM NaCl, 10% glycerol, 100mM imidiazole, 1mM ATP).

            Succinate dependent growth measurements were determined by growing single colonies picked from LB agar plates overnight at 37°C, and shaken at 250 rpm in 50mL cultures of minimal media described above with 50 mg/mL ampicillin, 34 mg/mL chloramphenicol, 30mM succinate, and 600mg/L casein hydrolysate. Overnight cultures were then inoculated into 1 L cultures of the same media, grown at 37°C and shaken at 250 rpm. Absorbance at 600nm was used as a measure of cell density, and the doubling time of each culture was determined in the log phase of growth.

The rate of ATP hydrolysis was measured with an ATP regenerating coupled assay that consisted of 50mM Tris-HCl pH 8.0, 10mM KCl, 2.5mM Phosphoenolpyruvate, 0.15mM-0.3mM NADH, 50mg/mL pyruvate kinase, 50mg/mL lactate dehydrogenase, 3nM F₁ with 2mM Mg²⁺-ATP. The rate was determined as the change in absorbance at 340nm using a Varian Cary 50 Bio UV-Visible spectrophotometer equipped with a stirred cell Peltier temperature control. The reaction was initiated by the addition of F₁ to the assay mixture. Reaction rates were calculated from data taken collected 8-10 minutes after initiation of the reaction to allow for dissociation of the e subunit and to minimize inhibition by entrapped Mg²⁺-ADP (11) . Arrhenius analysis of data to determine the entropic and enthalpic components of the free energy of activation were performed using standard equations (12) :

                                                                 E_A = DH^‡ + RT                                                 (Eq. 1)

   DG^‡ = DH^‡ - TDS^‡                                              (Eq. 2)

                                                        DG^‡ = -RT ln (Nh/RT × k_cat)                                       (Eq. 3)

where k_cat is the turnover number, E_A is the Arrhenius activation energy, N is Avogadro’s number, and DH^‡, and DS^‡ are the enthalpic and entropic components of the changes in Gibbs free energy of activation (DG^‡). All Mg²⁺-ATPase assays were accomplished within 5 days of the date at which the F₁-ATPase preparation was completed. After this period the preparations were found to lose activity as the result of an increase in the entropy of activation (data not shown).

Table 1. Comparison of the relative ability of mutant and XL10 strains to grow via oxidative phosphorylation and of purified F₁ ATPase to hydrolyze ATP.

^a Conditions for growth on succinate via oxidative phosphorylation were the same as described in Experimental Procedures; ^b No growth was observed because F₁F_o ATP synthase did not assemble; ^c No Growth observed after 13 h; ^d Conditions for ATP hydrolysis were the same as described in Experimental Procedures; ^e Not determined because F₁-ATPase did not assemble. 

Results

With the exception of bD305V and bD305S, the yield of F₁ purified from the site-directed mutants to remove g subunit-catch loop interactions was approximately the same as that isolated from the XL10 strain. Intact F₁-ATPase that contained the bD305V or the bD305S mutants was never successfully isolated and these mutations were presumed to interfere with assembly of the F₁F_o ATP synthase. The F₁-ATPase isolated from E. coli with the other mutations (gR268L, gQ269L, bD302T, bD302V, bT304A, or D305E) contained all five subunits as determined by SDS-polyacrylamide gel electrophoresis (data not shown). These results suggest that these latter mutations did not significantly affect the synthesis and assembly of the enzyme. 

            The relative ability of the mutant and wild type strains to grow via oxidative phosphorylation on minimal media in the presence of succinate was assessed by determining growth curves. The inability of bD305V and bD305S mutants to assemble intact F₁ ATPase, coupled with their inability to grow on minimal medium with succinate was utilized as negative controls that the growth rate was dependent on the rate of ATP synthesis catalyzed by the F₁F_o ATP synthase. The doubling times calculated from the growth curves are summarized in Table 1.

The F₁F_o demonstrated very little tolerance for substitution of bD305. In addition to the fact that substitution of this carboxyl for a hydroxyl prevented assembly of F₁, the most conservative mutation, bD305E, completely impaired the succinate-dependent growth rate. The strain that contained the gQ269L mutation was also unable to grow on succinate indicating that these residues are very important for ATP synthase activity. The ability of the strains that contained gR268L, bD302V, or bD302T mutants to grow on succinate was also significantly decreased. The doubling time of the strain containing gR268L was nearly twice that of XL10, while that of the strains that contained mutants of bD302 increased by about 1.5 fold. However, the rate of growth of the bT304A mutant on succinate was not affected. None of the mutations made to either the b or g subunits affected the ability of the bacteria to grow on minimal medium in presence of glucose. These results suggest that the poor growth on minimal media with succinate was the result of impairment of the ability of the F₁F_o complex to synthesize ATP. 

Figure 2. Arrhenius analysis of MgATPase activity catalyzed by soluble XL10-F₁ (®), bD302T-F₁ (l), bT304A-F₁ (n), gR268L-F₁ (m), bD305E-F₁ (¯), and gQ269L-F₁ (£). The concentration of F₁ used was 3nM for XL10-F₁, bD305E-F₁, and bT304-F₁ mutants, 9nM for the gR268L-F₁, 40nM for